Stem-loop sequence cpo-mir-3059

AccessionMI0038866 (change log)
DescriptionCavia porcellus miR-3059 stem-loop
Stem-loop
   -uuu   -    gc   a     u    cu 
5'     ccu cucu  ccc uaggg guag  c
       ||| ||||  ||| ||||| ||||   
3'     gga gaga  ggg aucuc cguc  u
   gguu   a    -a   -     c    aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562864.1: 13779749-13779806 [+]
intergenic
Database links

Mature sequence cpo-miR-3059-5p

Accession MIMAT0047433
Sequence

1 - 

uuuccucucugccccauagggugu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-3059-3p

Accession MIMAT0047434
Sequence

37 - 

ccucuagggaagagaagguugg

 - 58

Get sequence
Evidence not experimental

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).