Stem-loop sequence cpo-mir-2387

AccessionMI0038865 (change log)
DescriptionCavia porcellus miR-2387 stem-loop
Stem-loop
   --  -g      c  c       u   g 
5'   ug  aaggcc ag uuugcag gug a
     ||  |||||| || ||||||| ||| c
3'   ac  uuccgg uc agacguc cac u
   aa  ga      -  c       c   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS563089.1: 708165-708219 [-]
intergenic
Database links

Mature sequence cpo-miR-2387-5p

Accession MIMAT0047431
Sequence

1 - 

uggaaggcccagcuuugcagug

 - 22

Get sequence
Evidence not experimental

Mature sequence cpo-miR-2387-3p

Accession MIMAT0047432
Sequence

33 - 

ccugcagaccuggccuuagcaaa

 - 55

Get sequence
Evidence not experimental

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).