Stem-loop sequence cpo-mir-2355

AccessionMI0038864 (change log)
DescriptionCavia porcellus miR-2355 stem-loop
Stem-loop
   --   cu      -   u     au     auuau 
5'   guc  cagaua caa ggaca  augcu     a
     |||  |||||| ||| |||||  |||||     a
3'   uag  guuugu guu ccugu  uacgg     u
   aa   ag      c   -     --     cacgu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562868.1: 40713701-40713767 [-]
intergenic
Database links

Mature sequence cpo-miR-2355-5p

Accession MIMAT0047429
Sequence

1 - 

guccucagauacaauggacaau

 - 22

Get sequence
Evidence not experimental

Mature sequence cpo-miR-2355-3p

Accession MIMAT0047430
Sequence

46 - 

uguccuugcuguuuggagauaa

 - 67

Get sequence
Evidence not experimental

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).