Stem-loop sequence cpo-mir-1388

AccessionMI0038862 (change log)
DescriptionCavia porcellus miR-1388 stem-loop
Stem-loop
   --a  a   u c         aug   c   u 
5'    gg cug c aaccugaga   uug auc c
      || ||| | |||||||||   ||| |||  
3'    cc gac g uuggacucu   aac ugg c
   gug  c   u u         ---   -   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562974.1: 424300-424359 [+]
intergenic
Database links

Mature sequence cpo-miR-1388-5p

Accession MIMAT0047425
Sequence

1 - 

aggacuguccaaccugagaaug

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-1388-3p

Accession MIMAT0047426
Sequence

39 - 

aucucagguuugucagcccgug

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).