Stem-loop sequence cpo-mir-1379

AccessionMI0038861 (change log)
DescriptionCavia porcellus miR-1379 stem-loop
Stem-loop
   --uca   u  -       a   g    c 
5'      ggc cu cagcccg gcc uguu u
        ||| || ||||||| ||| |||| u
3'      ccg ga gucgggc cgg gcag c
   cgcaa   c  c       a   -    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562868.1: 2582941-2582997 [+]
intergenic
Database links

Mature sequence cpo-miR-1379-5p

Accession MIMAT0047423
Sequence

1 - 

ucaggcucucagcccgagcc

 - 20

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-1379-3p

Accession MIMAT0047424
Sequence

37 - 

cacgggcugcagcgccaacgc

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).