Stem-loop sequence cpo-mir-1343

AccessionMI0038860 (change log)
DescriptionCavia porcellus miR-1343 stem-loop
Stem-loop
   --u    a    c    c   c     ucu 
5'    gggg gcgg cccc ggg gggcc   g
      |||| |||| |||| ||| |||||    
3'    ucuc cgcc gggg ccu cccgg   c
   ugc    a    c    u   c     ucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562947.1: 3937276-3937335 [-]
intergenic
Database links

Mature sequence cpo-miR-1343-5p

Accession MIMAT0047421
Sequence

1 - 

uggggagcggccccccgggcgg

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-1343-3p

Accession MIMAT0047422
Sequence

39 - 

cuccuggggcccgcacucucgu

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).