Stem-loop sequence cpo-mir-1301

AccessionMI0038859 (change log)
DescriptionCavia porcellus miR-1301 stem-loop
Stem-loop
   --         -     - c      -  gu 
5'   ggucacucu aggca c gcagca cu  g
     ||||||||| ||||| | |||||| ||  c
3'   ucagugagg uccgu g cguugu gg  u
   cu         g     c a      a  gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562873.1: 7256957-7257016 [-]
intergenic
Database links

Mature sequence cpo-miR-1301-5p

Accession MIMAT0047419
Sequence

1 - 

ggucacucuaggcaccgcagca

 - 22

Get sequence
Evidence not experimental

Mature sequence cpo-miR-1301-3p

Accession MIMAT0047420
Sequence

37 - 

uugcagcugccugggagugacuuc

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).