Stem-loop sequence cpo-mir-1298

AccessionMI0038858 (change log)
DescriptionCavia porcellus miR-1298 stem-loop
Stem-loop
   --    u    a             ------       cc 
5'   uuca ucag uguucagauguau      ccaagua  u
     |||| |||| |||||||||||||      |||||||   
3'   aagu aguc acgggucuacaua      gguuuau  a
   uc    u    a             aauaac       ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562901.1: 5210415-5210488 [-]
intergenic
Database links

Mature sequence cpo-miR-1298-5p

Accession MIMAT0047417
Sequence

1 - 

uucauucagauguucagaugua

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-1298-3p

Accession MIMAT0047418
Sequence

53 - 

caucugggcaacugauugaacu

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).