Stem-loop sequence cpo-mir-1296

AccessionMI0038857 (change log)
DescriptionCavia porcellus miR-1296 stem-loop
Stem-loop
   --      c cu        cu   u     a 
5'   uuaggg c  ggcuccau  ccu uagga a
     |||||| |  ||||||||  ||| ||||| a
3'   aauccc g  ucggggug  ggg gucuu c
   cc      a uu        ag   u     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562870.1: 13768767-13768831 [-]
intergenic
Database links

Mature sequence cpo-miR-1296-5p

Accession MIMAT0047415
Sequence

1 - 

uuagggcccuggcuccaucucc

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-1296-3p

Accession MIMAT0047416
Sequence

45 - 

aguggggcuuugacccuaacc

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).