Stem-loop sequence cpo-mir-1277

AccessionMI0038856 (change log)
DescriptionCavia porcellus miR-1277 stem-loop
Stem-loop
   --u            g        ug au 
5'    auauauauauau uacguaug  u  a
      |||||||||||| ||||||||  |   
3'    uauguauauaua augcauau  a  u
   uuu            g        gu aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562901.1: 1242411-1242468 [-]
intergenic
Database links

Mature sequence cpo-miR-1277-5p

Accession MIMAT0047413
Sequence

1 - 

uauauauauauauguacguaug

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-1277-3p

Accession MIMAT0047414
Sequence

37 - 

uacguagauauauauguauuuu

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).