Stem-loop sequence cpo-mir-1264

AccessionMI0038854 (change log)
DescriptionCavia porcellus miR-1264 stem-loop
Stem-loop
   --    c     -    u         aaaaa 
5'   aggu cucaa uaag auuuguuga     u
     |||| ||||| |||| |||||||||     a
3'   ucca gaguu auuc ugaacaacu     a
   ug    c     u    -         aagua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562901.1: 5270718-5270780 [-]
intergenic
Database links

Mature sequence cpo-miR-1264-5p

Accession MIMAT0047409
Sequence

1 - 

agguccucaauaaguauuuguu

 - 22

Get sequence
Evidence not experimental

Mature sequence cpo-miR-1264-3p

Accession MIMAT0047410
Sequence

42 - 

caagucuuauuugagcaccugu

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).