Stem-loop sequence cpo-mir-1251

AccessionMI0038853 (change log)
DescriptionCavia porcellus miR-1251 stem-loop
Stem-loop
   --  u  a    cca         --c  c 
5'   ac cu gcug   aaggcgcuu   uc u
     || || ||||   |||||||||   || u
3'   ug ga cgac   uuucgcgag   ag c
   ga  u  c    ucg         aca  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562864.1: 4581323-4581381 [-]
intergenic
Database links

Mature sequence cpo-miR-1251-5p

Accession MIMAT0047407
Sequence

1 - 

acucuagcugccaaaggcgcu

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-1251-3p

Accession MIMAT0047408
Sequence

39 - 

cgcuuugcucagccaguguag

 - 59

Get sequence
Evidence not experimental

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).