Stem-loop sequence cpo-mir-1247

AccessionMI0038852 (change log)
DescriptionCavia porcellus miR-1247 stem-loop
Stem-loop
   --a  c   c  uu  uc     ac   gc 
5'    cc guc cg  cg  cccgg  guu  u
      || ||| ||  ||  |||||  |||   
3'    gg cag gc  gc  gggcc  cgg  c
   cga  u   a  -u  ga     -c   gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 1834425-1834482 [-]
intergenic
Database links

Mature sequence cpo-miR-1247-5p

Accession MIMAT0047405
Sequence

1 - 

acccgucccguucguccccgga

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-1247-3p

Accession MIMAT0047406
Sequence

38 - 

cgggagcgucgagacuggagc

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).