Stem-loop sequence cpo-mir-1197

AccessionMI0038851 (change log)
DescriptionCavia porcellus miR-1197 stem-loop
Stem-loop
   --c   u       -  g ----g     u 
5'    ggu gaccaug gu u     uacgc u
      ||| ||||||| || |     ||||| u
3'    uca cugguac ca g     gugug a
   ucu   u       a  g augca     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 1085473-1085528 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-1197
cpo-mir-379DS562966.1: 1082082-1082140 [+]
cpo-mir-411DS562966.1: 1083271-1083326 [+]
cpo-mir-299DS562966.1: 1083722-1083784 [+]
cpo-mir-380DS562966.1: 1084914-1084970 [+]
cpo-mir-1197DS562966.1: 1085473-1085528 [+]
cpo-mir-323aDS562966.1: 1085632-1085687 [+]
cpo-mir-758DS562966.1: 1085914-1085971 [+]
cpo-mir-329DS562966.1: 1086616-1086675 [+]
cpo-mir-494DS562966.1: 1088359-1088414 [+]
cpo-mir-1193DS562966.1: 1088694-1088748 [+]
cpo-mir-543DS562966.1: 1090491-1090547 [+]
cpo-mir-495DS562966.1: 1091798-1091855 [+]
cpo-mir-376cDS562966.1: 1095062-1095119 [+]
cpo-mir-376dDS562966.1: 1095388-1095445 [+]
Database links

Mature sequence cpo-miR-1197-5p

Accession MIMAT0047403
Sequence

1 - 

cgguugaccaugguguguacg

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-1197-3p

Accession MIMAT0047404
Sequence

36 - 

uaggacacauggucuacuucu

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).