Stem-loop sequence cpo-mir-1193

AccessionMI0038850 (change log)
DescriptionCavia porcellus miR-1193 stem-loop
Stem-loop
   --    -    c      g    cu  au 
5'   uggu agac ggugac ugca  uc  u
     |||| |||| |||||| ||||  ||   
3'   auca uuug ccacug augu  ag  u
   cu    c    c      g    --  ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 1088694-1088748 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-1193
cpo-mir-379DS562966.1: 1082082-1082140 [+]
cpo-mir-411DS562966.1: 1083271-1083326 [+]
cpo-mir-299DS562966.1: 1083722-1083784 [+]
cpo-mir-380DS562966.1: 1084914-1084970 [+]
cpo-mir-1197DS562966.1: 1085473-1085528 [+]
cpo-mir-323aDS562966.1: 1085632-1085687 [+]
cpo-mir-758DS562966.1: 1085914-1085971 [+]
cpo-mir-329DS562966.1: 1086616-1086675 [+]
cpo-mir-494DS562966.1: 1088359-1088414 [+]
cpo-mir-1193DS562966.1: 1088694-1088748 [+]
cpo-mir-543DS562966.1: 1090491-1090547 [+]
cpo-mir-495DS562966.1: 1091798-1091855 [+]
cpo-mir-376cDS562966.1: 1095062-1095119 [+]
cpo-mir-376dDS562966.1: 1095388-1095445 [+]
cpo-mir-654DS562966.1: 1095544-1095600 [+]
cpo-mir-376bDS562966.1: 1095759-1095816 [+]
cpo-mir-376aDS562966.1: 1096085-1096142 [+]
cpo-mir-1185DS562966.1: 1097764-1097823 [+]
Database links

Mature sequence cpo-miR-1193-5p

Accession MIMAT0047401
Sequence

1 - 

ugguagaccggugacgugcacu

 - 22

Get sequence
Evidence not experimental

Mature sequence cpo-miR-1193-3p

Accession MIMAT0047402
Sequence

33 - 

uguaggucacccguuucacuauc

 - 55

Get sequence
Evidence not experimental

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).