Stem-loop sequence cpo-mir-889

AccessionMI0038848 (change log)
DescriptionCavia porcellus miR-889 stem-loop
Stem-loop
   --     c      uagug     -  -  u 
5'   aaugg uguccg     ugguc uc ua a
     ||||| ||||||     ||||| || ||  
3'   uuacc acaggc     auuag ag au u
   ug     a      -uaua     u  c  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 1101145-1101203 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-889
cpo-mir-495DS562966.1: 1091798-1091855 [+]
cpo-mir-376cDS562966.1: 1095062-1095119 [+]
cpo-mir-376dDS562966.1: 1095388-1095445 [+]
cpo-mir-654DS562966.1: 1095544-1095600 [+]
cpo-mir-376bDS562966.1: 1095759-1095816 [+]
cpo-mir-376aDS562966.1: 1096085-1096142 [+]
cpo-mir-1185DS562966.1: 1097764-1097823 [+]
cpo-mir-381DS562966.1: 1099199-1099261 [+]
cpo-mir-487bDS562966.1: 1099737-1099794 [+]
cpo-mir-539DS562966.1: 1100599-1100662 [+]
cpo-mir-889DS562966.1: 1101145-1101203 [+]
cpo-mir-655DS562966.1: 1102750-1102809 [+]
cpo-mir-3959DS562966.1: 1104334-1104387 [+]
cpo-mir-487aDS562966.1: 1104622-1104679 [+]
cpo-mir-382DS562966.1: 1107038-1107096 [+]
cpo-mir-134DS562966.1: 1107399-1107459 [+]
cpo-mir-485DS562966.1: 1108140-1108198 [+]
Database links

Mature sequence cpo-miR-889-5p

Accession MIMAT0047397
Sequence

1 - 

aauggcuguccguagugugguc

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-889-3p

Accession MIMAT0047398
Sequence

39 - 

uuaauaucggacaaccauugu

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).