Stem-loop sequence cpo-mir-885

AccessionMI0038847 (change log)
DescriptionCavia porcellus miR-885 stem-loop
Stem-loop
   --       caa     ---     c   u 
5'   uccacua   ugccu   ugccu uuc c
     |||||||   |||||   ||||| |||  
3'   aggugau   auggg   acgga agg c
   ac       ---     acg     a   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562942.1: 429438-429491 [+]
intergenic
Database links

Mature sequence cpo-miR-885-5p

Accession MIMAT0047395
Sequence

1 - 

uccacuacaaugccuugccucu

 - 22

Get sequence
Evidence not experimental

Mature sequence cpo-miR-885-3p

Accession MIMAT0047396
Sequence

33 - 

aggcagcaggguauaguggaca

 - 54

Get sequence
Evidence not experimental

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).