Stem-loop sequence cpo-mir-874

AccessionMI0038846 (change log)
DescriptionCavia porcellus miR-874 stem-loop
Stem-loop
   --   c   a  ca        a ag  a 
5'   cgg ccc cg  ccagggua g  ag c
     ||| ||| ||  |||||||| |  || u
3'   gcc ggg gc  ggucccgu c  uc c
   ca   a   a  cc        - cu  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562872.1: 26200294-26200351 [-]
intergenic
Database links

Mature sequence cpo-miR-874-5p

Accession MIMAT0047393
Sequence

1 - 

cggccccacgcaccaggguaaga

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-874-3p

Accession MIMAT0047394
Sequence

36 - 

cugcccuggcccgagggaccgac

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).