Stem-loop sequence cpo-mir-873

AccessionMI0038845 (change log)
DescriptionCavia porcellus miR-873 stem-loop
Stem-loop
   --ug a      ug g        a  aa 
5'     c ggaacu  u agucuccu uu  a
       | ||||||  | |||||||| ||  a
3'     g ccuuga  a ucagagga aa  a
   aagg c      gu g        c  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562857.1: 7394199-7394257 [-]
intergenic
Database links

Mature sequence cpo-miR-873-5p

Accession MIMAT0047391
Sequence

1 - 

ugcaggaacuugugagucuccu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-873-3p

Accession MIMAT0047392
Sequence

38 - 

gagacugaugaguucccgggaa

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).