Stem-loop sequence cpo-mir-872

AccessionMI0038844 (change log)
DescriptionCavia porcellus miR-872 stem-loop
Stem-loop
   --a        -ugu         accucau 
5'    agguuacu    uaguucagg       u
      ||||||||    |||||||||        
3'    uccgauga    aucaagucc       c
   ucc        uguu         guccuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562857.1: 5601257-5601317 [+]
intergenic
Database links

Mature sequence cpo-miR-872-5p

Accession MIMAT0047389
Sequence

1 - 

aagguuacuuguuaguucagg

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-872-3p

Accession MIMAT0047390
Sequence

40 - 

ugaacuauuguaguagccuccu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).