Stem-loop sequence cpo-mir-802

AccessionMI0038843 (change log)
DescriptionCavia porcellus miR-802 stem-loop
Stem-loop
   --uc   a          a       gucaa 
5'     agu acaaagauuc uucuugu     u
       ||| |||||||||| |||||||      
3'     uca uguuucuaag aggaaca     c
   uacu   c          -       acaca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS563001.1: 392819-392879 [-]
intergenic
Database links

Mature sequence cpo-miR-802-5p

Accession MIMAT0047387
Sequence

1 - 

ucaguaacaaagauucauucuugu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-802-3p

Accession MIMAT0047388
Sequence

39 - 

aaggagaaucuuugucacuucau

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).