Stem-loop sequence cpo-mir-769

AccessionMI0038842 (change log)
DescriptionCavia porcellus miR-769 stem-loop
Stem-loop
   ---u        u   u   g    -gu  ua 
5'     gagaccuc ggg ucu agcu   ga  u
       |||||||| ||| ||| ||||   ||   
3'     uucugggg cuc agg ucga   cu  u
   uugg        c   u   g    guc  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562935.1: 6337196-6337257 [+]
intergenic
Database links

Mature sequence cpo-miR-769-5p

Accession MIMAT0047385
Sequence

1 - 

ugagaccucuggguucugagcu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-769-3p

Accession MIMAT0047386
Sequence

40 - 

cugggaucuccggggucuugguu

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).