Stem-loop sequence cpo-mir-760

AccessionMI0038841 (change log)
DescriptionCavia porcellus miR-760 stem-loop
Stem-loop
   --     u   u ug        c    gcc 
5'   ccccc cag c  ccagagcc ggau   u
     ||||| ||| |  |||||||| ||||   c
3'   ggggg guc g  ggucucgg cuua   a
   ca     u   u --        -    aag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562857.1: 19580893-19580952 [+]
intergenic
Database links

Mature sequence cpo-miR-760-5p

Accession MIMAT0047383
Sequence

1 - 

cccccucagucugccagagcccgga

 - 25

Get sequence
Evidence not experimental

Mature sequence cpo-miR-760-3p

Accession MIMAT0047384
Sequence

39 - 

cggcucugggucugugggggac

 - 60

Get sequence
Evidence not experimental

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).