Stem-loop sequence cpo-mir-758

AccessionMI0038840 (change log)
DescriptionCavia porcellus miR-758 stem-loop
Stem-loop
   --a    u      aga   c   c   a 
5'    uggu gaccag   gca acg uau u
      |||| ||||||   ||| ||| |||  
3'    auca cugguc   ugu ugc gug u
   cca    c      cag   u   c   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 1085914-1085971 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-758
cpo-mir-379DS562966.1: 1082082-1082140 [+]
cpo-mir-411DS562966.1: 1083271-1083326 [+]
cpo-mir-299DS562966.1: 1083722-1083784 [+]
cpo-mir-380DS562966.1: 1084914-1084970 [+]
cpo-mir-1197DS562966.1: 1085473-1085528 [+]
cpo-mir-323aDS562966.1: 1085632-1085687 [+]
cpo-mir-758DS562966.1: 1085914-1085971 [+]
cpo-mir-329DS562966.1: 1086616-1086675 [+]
cpo-mir-494DS562966.1: 1088359-1088414 [+]
cpo-mir-1193DS562966.1: 1088694-1088748 [+]
cpo-mir-543DS562966.1: 1090491-1090547 [+]
cpo-mir-495DS562966.1: 1091798-1091855 [+]
cpo-mir-376cDS562966.1: 1095062-1095119 [+]
cpo-mir-376dDS562966.1: 1095388-1095445 [+]
cpo-mir-654DS562966.1: 1095544-1095600 [+]
cpo-mir-376bDS562966.1: 1095759-1095816 [+]
Database links

Mature sequence cpo-miR-758-5p

Accession MIMAT0047381
Sequence

1 - 

augguugaccagagagcacacg

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-758-3p

Accession MIMAT0047382
Sequence

37 - 

uuugugaccugguccacuaacc

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).