Stem-loop sequence cpo-mir-744

AccessionMI0038839 (change log)
DescriptionCavia porcellus miR-744 stem-loop
Stem-loop
   -ugc    c   -   u       gucuuacugaagguu 
5'     gggg uag ggc aacagca               u
       |||| ||| ||| |||||||               c
3'     cucc auc ccg uugucgu               c
   ccaa    a   a   -       acacacaccaaaggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562916.1: 4870323-4870400 [-]
intergenic
Database links

Mature sequence cpo-miR-744-5p

Accession MIMAT0047379
Sequence

1 - 

ugcggggcuagggcuaacagca

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-744-3p

Accession MIMAT0047380
Sequence

58 - 

cuguugccacuaaccucaacc

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).