Stem-loop sequence cpo-mir-708

AccessionMI0038838 (change log)
DescriptionCavia porcellus miR-708 stem-loop
Stem-loop
   --a           a     c  g gg  ga  a 
5'    aggagcuuaca ucuag ug g  ua  ug c
      ||||||||||| ||||| || |  ||  || u
3'    ucuucgagugu agauc ac c  gu  ac u
   aga           c     a  a aa  ac  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562895.1: 13990350-13990418 [+]
intergenic
Database links

Mature sequence cpo-miR-708-5p

Accession MIMAT0047377
Sequence

1 - 

aaggagcuuacaaucuagcuggg

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-708-3p

Accession MIMAT0047378
Sequence

47 - 

caacuagacugugagcuucuaga

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).