Stem-loop sequence cpo-mir-675

AccessionMI0038836 (change log)
DescriptionCavia porcellus miR-675 stem-loop
Stem-loop
   --   c    ag     cc      gacu 
5'   ugg gcgg  agggc  acagug    u
     ||| ||||  |||||  ||||||     
3'   acu cgcc  ucccg  ugucac    g
   cg   -    aa     ua      agug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562897.1: 12522087-12522143 [+]
intergenic
Database links

Mature sequence cpo-miR-675-5p

Accession MIMAT0047373
Sequence

1 - 

uggcgcggagagggcccacagug

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-675-3p

Accession MIMAT0047374
Sequence

36 - 

cuguaugcccuaaccgcucagc

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).