Stem-loop sequence cpo-mir-672

AccessionMI0038835 (change log)
DescriptionCavia porcellus miR-672 stem-loop
Stem-loop
   --   gg -     ua       u     uac 
5'   uga  u uggug  cugugug gggua   a
     |||  | |||||  ||||||| |||||    
3'   acu  g aucac  gacacac ccuau   u
   aa   uu u     -c       -     uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562881.1: 21954918-21954978 [+]
intergenic
Database links

Mature sequence cpo-miR-672-5p

Accession MIMAT0047371
Sequence

1 - 

ugagguugguguacugugugugg

 - 23

Get sequence
Evidence not experimental

Mature sequence cpo-miR-672-3p

Accession MIMAT0047372
Sequence

39 - 

ccacacagccacuauguuucaaa

 - 61

Get sequence
Evidence not experimental

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).