Stem-loop sequence cpo-mir-671

AccessionMI0038834 (change log)
DescriptionCavia porcellus miR-671 stem-loop
Stem-loop
   --a   a      ga           -u   g 
5'    gga gcccug  ggggcuggagg  gau g
      ||| ||||||  |||||||||||  |||  
3'    ccu cgggac  ucuuggccucc  uug a
   cca   -      --           uu   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562887.1: 932637-932696 [+]
intergenic
Database links

Mature sequence cpo-miR-671-5p

Accession MIMAT0047369
Sequence

1 - 

aggaagcccuggaggggcuggagg

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-671-3p

Accession MIMAT0047370
Sequence

40 - 

uccgguucucagggcuccacc

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).