Stem-loop sequence cpo-mir-670

AccessionMI0038833 (change log)
DescriptionCavia porcellus miR-670 stem-loop
Stem-loop
   --guc        ua    - ug    ug au 
5'      ccugagug  ugug g  aacc  a  u
        ||||||||  |||| |  ||||  |  u
3'      ggacuuac  auac c  uugg  u  g
   uguga        uc    u cu    gu cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562927.1: 3601388-3601451 [+]
intergenic
Database links

Mature sequence cpo-miR-670-5p

Accession MIMAT0047367
Sequence

1 - 

gucccugaguguauguggugaacc

 - 24

Get sequence
Evidence not experimental

Mature sequence cpo-miR-670-3p

Accession MIMAT0047368
Sequence

40 - 

uuuccucauacucauucaggagugu

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).