Stem-loop sequence cpo-mir-660

AccessionMI0038832 (change log)
DescriptionCavia porcellus miR-660 stem-loop
Stem-loop
   ---uac    u      c    u   gaau 
5'       ccau gcauau ggag ugu    u
         |||| |||||| |||| |||    c
3'       ggua cguaug ccuc aua    u
   auauua    -      u    u   aaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562987.1: 3012570-3012628 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-660
cpo-mir-532DS562987.1: 3003104-3003162 [+]
cpo-mir-188DS562987.1: 3003465-3003524 [+]
cpo-mir-500aDS562987.1: 3008302-3008367 [+]
cpo-mir-362DS562987.1: 3009085-3009144 [+]
cpo-mir-501DS562987.1: 3009773-3009832 [+]
cpo-mir-500bDS562987.1: 3010278-3010339 [+]
cpo-mir-660DS562987.1: 3012570-3012628 [+]
cpo-mir-502aDS562987.1: 3014248-3014306 [+]
Database links

Mature sequence cpo-miR-660-5p

Accession MIMAT0047365
Sequence

1 - 

uacccauugcauaucggaguugu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-660-3p

Accession MIMAT0047366
Sequence

37 - 

aucuccuguaugcauggauuaua

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).