Stem-loop sequence cpo-mir-656

AccessionMI0038831 (change log)
DescriptionCavia porcellus miR-656 stem-loop
Stem-loop
   --      c     ag       cuu  u 
5'   agguug cugug  guguuca   uc a
     |||||| |||||  |||||||   || u
3'   uccaac gacau  uauaagu   ag a
   uc      u     au       ---  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 1118353-1118408 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-656
cpo-mir-154DS562966.1: 1112305-1112362 [+]
cpo-mir-496DS562966.1: 1113040-1113093 [+]
cpo-mir-377DS562966.1: 1114436-1114495 [+]
cpo-mir-541DS562966.1: 1116256-1116321 [+]
cpo-mir-409DS562966.1: 1117072-1117125 [+]
cpo-mir-412DS562966.1: 1117221-1117276 [+]
cpo-mir-369DS562966.1: 1117336-1117391 [+]
cpo-mir-410DS562966.1: 1117656-1117711 [+]
cpo-mir-323bDS562966.1: 1118056-1118114 [+]
cpo-mir-656DS562966.1: 1118353-1118408 [+]
Database links

Mature sequence cpo-miR-656-5p

Accession MIMAT0047363
Sequence

1 - 

agguugccugugagguguuca

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-656-3p

Accession MIMAT0047364
Sequence

36 - 

aauauuauacagucaaccucu

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).