Stem-loop sequence cpo-mir-654

AccessionMI0038829 (change log)
DescriptionCavia porcellus miR-654 stem-loop
Stem-loop
   --a      g u     a     gcu      
5'    uggugg c gcgga caugu   ggccu 
      |||||| | ||||| |||||   |||| c
3'    acuacc g cgucu guaca   ccggg 
   ucc      a c     -     ---      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 1095544-1095600 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-654
cpo-mir-323aDS562966.1: 1085632-1085687 [+]
cpo-mir-758DS562966.1: 1085914-1085971 [+]
cpo-mir-329DS562966.1: 1086616-1086675 [+]
cpo-mir-494DS562966.1: 1088359-1088414 [+]
cpo-mir-1193DS562966.1: 1088694-1088748 [+]
cpo-mir-543DS562966.1: 1090491-1090547 [+]
cpo-mir-495DS562966.1: 1091798-1091855 [+]
cpo-mir-376cDS562966.1: 1095062-1095119 [+]
cpo-mir-376dDS562966.1: 1095388-1095445 [+]
cpo-mir-654DS562966.1: 1095544-1095600 [+]
cpo-mir-376bDS562966.1: 1095759-1095816 [+]
cpo-mir-376aDS562966.1: 1096085-1096142 [+]
cpo-mir-1185DS562966.1: 1097764-1097823 [+]
cpo-mir-381DS562966.1: 1099199-1099261 [+]
cpo-mir-487bDS562966.1: 1099737-1099794 [+]
cpo-mir-539DS562966.1: 1100599-1100662 [+]
cpo-mir-889DS562966.1: 1101145-1101203 [+]
cpo-mir-655DS562966.1: 1102750-1102809 [+]
cpo-mir-3959DS562966.1: 1104334-1104387 [+]
cpo-mir-487aDS562966.1: 1104622-1104679 [+]
Database links

Mature sequence cpo-miR-654-5p

Accession MIMAT0047359
Sequence

1 - 

auggugggcugcggaacaugug

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-654-3p

Accession MIMAT0047360
Sequence

37 - 

caugucugccgaccaucaccu

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).