Stem-loop sequence cpo-mir-653

AccessionMI0038828 (change log)
DescriptionCavia porcellus miR-653 stem-loop
Stem-loop
   --        cu     c     ca  cu 
5'   uugaaaca  cucua ugaac  gg  c
     ||||||||  ||||| |||||  ||  c
3'   gacuuugu  gaggu acuug  cc  a
   au        uu     c     aa  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562866.1: 25053804-25053862 [-]
intergenic
Database links

Mature sequence cpo-miR-653-5p

Accession MIMAT0047357
Sequence

1 - 

uugaaacacucucuacugaacc

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-653-3p

Accession MIMAT0047358
Sequence

38 - 

uucacuggaguuuguuucagua

 - 59

Get sequence
Evidence not experimental

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).