Stem-loop sequence cpo-mir-615

AccessionMI0038826 (change log)
DescriptionCavia porcellus miR-615 stem-loop
Stem-loop
   --     -uc     u         uc  g   g 
5'   ggggg   cccgg gcucggauc  ga agu c
     |||||   ||||| |||||||||  || |||  
3'   cuccc   ggguc cgagccugg  uu uua u
   uu     ucu     -         -c  g   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562864.1: 45777679-45777743 [-]
intergenic
Database links

Mature sequence cpo-miR-615-5p

Accession MIMAT0047353
Sequence

1 - 

ggggguccccggugcucggauc

 - 22

Get sequence
Evidence not experimental

Mature sequence cpo-miR-615-3p

Accession MIMAT0047354
Sequence

44 - 

uccgagccugggucucccucuu

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).