Stem-loop sequence cpo-mir-582

AccessionMI0038825 (change log)
DescriptionCavia porcellus miR-582 stem-loop
Stem-loop
   --uua             a     u    u 
5'      caguuguucaacc guuac aauu a
        ||||||||||||| ||||| |||| a
3'      gucaacaaguugg caaug uuaa c
   cccaa             c     -    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562884.1: 2467345-2467404 [+]
intergenic
Database links

Mature sequence cpo-miR-582-5p

Accession MIMAT0047351
Sequence

1 - 

uuacaguuguucaaccaguuacu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-582-3p

Accession MIMAT0047352
Sequence

38 - 

uaaccgguugaacaacugaaccc

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).