Stem-loop sequence cpo-mir-551

AccessionMI0038823 (change log)
DescriptionCavia porcellus miR-551 stem-loop
Stem-loop
   --         cg     ga a   gg g g 
5'   gaaaucaag  ugggu  g ccu  u c g
     |||||||||  |||||  | |||  | |  
3'   cuuugguuc  accca  c gga  g g a
   ga         au     -g -   ag g a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562955.1: 1116239-1116298 [+]
intergenic
Database links

Mature sequence cpo-miR-551-5p

Accession MIMAT0047347
Sequence

1 - 

gaaaucaagcgugggugagaccu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-551-3p

Accession MIMAT0047348
Sequence

40 - 

gcgacccauacuugguuucag

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).