Stem-loop sequence cpo-mir-545

AccessionMI0038822 (change log)
DescriptionCavia porcellus miR-545 stem-loop
Stem-loop
   --c       c      auug     auaaa 
5'    cacagua auguuu    gauga     u
      ||||||| ||||||    |||||     g
3'    guguuau uacaga    cuacu     a
   cgu       u      -caa     gagua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562881.1: 22993124-22993185 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-545
cpo-mir-374DS562881.1: 22992971-22993022 [+]
cpo-mir-545DS562881.1: 22993124-22993185 [+]
Database links

Mature sequence cpo-miR-545-5p

Accession MIMAT0047345
Sequence

1 - 

ccacaguacauguuuauuggaug

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-545-3p

Accession MIMAT0047346
Sequence

41 - 

ucaacagacauuuauugugugc

 - 62

Get sequence
Evidence not experimental

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).