Stem-loop sequence cpo-mir-542

AccessionMI0038820 (change log)
DescriptionCavia porcellus miR-542 stem-loop
Stem-loop
   --    gg    uca      c  -a   c 
5'   ucgg  auca   ugucac ag  uac a
     ||||  ||||   |||||| ||  |||  
3'   aguc  uagu   acagug uc  gug u
   aa    aa    uag      u  gc   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562983.1: 2874159-2874217 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-542
cpo-mir-424DS562983.1: 2879319-2879377 [-]
cpo-mir-503DS562983.1: 2878959-2879021 [-]
cpo-mir-542DS562983.1: 2874159-2874217 [-]
cpo-mir-450a-2DS562983.1: 2873272-2873328 [-]
cpo-mir-450a-1DS562983.1: 2873102-2873159 [-]
cpo-mir-450bDS562983.1: 2872948-2873006 [-]
Database links

Mature sequence cpo-miR-542-5p

Accession MIMAT0047341
Sequence

1 - 

ucggggaucaucaugucaccag

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-542-3p

Accession MIMAT0047342
Sequence

38 - 

ugugacagauugauaacugaaa

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).