Stem-loop sequence cpo-mir-539

AccessionMI0038818 (change log)
DescriptionCavia porcellus miR-539 stem-loop
Stem-loop
   --         a      g    -   --a  uu 
5'   ggagaaauu uccuug ugug uuc   cu  a
     ||||||||| |||||| |||| |||   ||   
3'   uuucuuuaa aggaac auac aag   ga  u
   uu         c      -    u   aag  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 1100599-1100662 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-539
cpo-mir-495DS562966.1: 1091798-1091855 [+]
cpo-mir-376cDS562966.1: 1095062-1095119 [+]
cpo-mir-376dDS562966.1: 1095388-1095445 [+]
cpo-mir-654DS562966.1: 1095544-1095600 [+]
cpo-mir-376bDS562966.1: 1095759-1095816 [+]
cpo-mir-376aDS562966.1: 1096085-1096142 [+]
cpo-mir-1185DS562966.1: 1097764-1097823 [+]
cpo-mir-381DS562966.1: 1099199-1099261 [+]
cpo-mir-487bDS562966.1: 1099737-1099794 [+]
cpo-mir-539DS562966.1: 1100599-1100662 [+]
cpo-mir-889DS562966.1: 1101145-1101203 [+]
cpo-mir-655DS562966.1: 1102750-1102809 [+]
cpo-mir-3959DS562966.1: 1104334-1104387 [+]
cpo-mir-487aDS562966.1: 1104622-1104679 [+]
cpo-mir-382DS562966.1: 1107038-1107096 [+]
cpo-mir-134DS562966.1: 1107399-1107459 [+]
cpo-mir-485DS562966.1: 1108140-1108198 [+]
Database links

Mature sequence cpo-miR-539-5p

Accession MIMAT0047337
Sequence

1 - 

ggagaaauuauccuugguguguu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-539-3p

Accession MIMAT0047338
Sequence

43 - 

cauacaaggacaauuucuuuuu

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).