Stem-loop sequence cpo-mir-532

AccessionMI0038817 (change log)
DescriptionCavia porcellus miR-532 stem-loop
Stem-loop
   --  u      a    a   ccguu  c  cu 
5'   ca gccuug gugu gga     gg gu  u
     || |||||| |||| |||     || ||  a
3'   gu cggaac caca ccu     cc ca  a
   ac  u      c    c   -----  -  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562987.1: 3003104-3003162 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-532
cpo-mir-532DS562987.1: 3003104-3003162 [+]
cpo-mir-188DS562987.1: 3003465-3003524 [+]
cpo-mir-500aDS562987.1: 3008302-3008367 [+]
cpo-mir-362DS562987.1: 3009085-3009144 [+]
cpo-mir-501DS562987.1: 3009773-3009832 [+]
cpo-mir-500bDS562987.1: 3010278-3010339 [+]
cpo-mir-660DS562987.1: 3012570-3012628 [+]
Database links

Mature sequence cpo-miR-532-5p

Accession MIMAT0047335
Sequence

1 - 

caugccuugaguguaggaccgu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-532-3p

Accession MIMAT0047336
Sequence

38 - 

ccucccacacccaaggcuugca

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).