Stem-loop sequence cpo-mir-509f

AccessionMI0038816 (change log)
DescriptionCavia porcellus miR-509f stem-loop
Stem-loop
   -      a        c       gaug 
5'  uucccc acggcugu aaucaua    a
    |||||| |||||||| |||||||     
3'  gagggg ugucggca uuagugu    u
   a      g        a       aaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562939.1: 2722022-2722078 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-509f
cpo-mir-509dDS562939.1: 2715444-2715500 [+]
cpo-mir-509fDS562939.1: 2722022-2722078 [+]
cpo-mir-509eDS562939.1: 2725364-2725420 [+]
Database links

Mature sequence cpo-miR-509f-5p

Accession MIMAT0047333
Sequence

1 - 

uuccccaacggcugucaaucaua

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-509f-3p

Accession MIMAT0047334
Sequence

36 - 

ugauuaacggcugugggggaga

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).