Stem-loop sequence cpo-mir-511

AccessionMI0038815 (change log)
DescriptionCavia porcellus miR-511 stem-loop
Stem-loop
   --ca           cu   g   g     a 
5'     ugucuuuugcu  gca uca uaaau u
       |||||||||||  ||| ||| |||||  
3'     acagaagacga  ugu agu guuua u
   ucag           ug   a   -     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562975.1: 1077095-1077155 [-]
intergenic
Database links

Mature sequence cpo-miR-511-5p

Accession MIMAT0047331
Sequence

1 - 

caugucuuuugcucugcaguca

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-511-3p

Accession MIMAT0047332
Sequence

40 - 

aauguguagcagaagacagacu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).