Stem-loop sequence cpo-mir-509e

AccessionMI0038814 (change log)
DescriptionCavia porcellus miR-509e stem-loop
Stem-loop
   --         ga   u       uua  u 
5'   ucccucaga  guu caaucau   uc u
     |||||||||  ||| |||||||   ||  
3'   agggagucu  cga guuagua   ag u
   ag         -a   c       --c  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562939.1: 2725364-2725420 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-509e
cpo-mir-509dDS562939.1: 2715444-2715500 [+]
cpo-mir-509fDS562939.1: 2722022-2722078 [+]
cpo-mir-509eDS562939.1: 2725364-2725420 [+]
Database links

Mature sequence cpo-miR-509e-5p

Accession MIMAT0047329
Sequence

1 - 

ucccucagagaguuucaaucauu

 - 23

Get sequence
Evidence not experimental

Mature sequence cpo-miR-509e-3p

Accession MIMAT0047330
Sequence

36 - 

ugauugcagcaucugagggaga

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).