Stem-loop sequence cpo-mir-509c

AccessionMI0038812 (change log)
DescriptionCavia porcellus miR-509c stem-loop
Stem-loop
   --a     c     a     a     uu  a 
5'    cuacc cagag guuuc aucgu  uu a
      ||||| ||||| ||||| |||||  ||  
3'    ggugg gucuc caaag uagua  aa u
   uua     a     -     a     uc  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562939.1: 2752734-2752794 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-509c
cpo-mir-509bDS562939.1: 2748262-2748318 [+]
cpo-mir-509cDS562939.1: 2752734-2752794 [+]
cpo-mir-507aDS562939.1: 2762224-2762281 [+]
Database links

Mature sequence cpo-miR-509c-5p

Accession MIMAT0047325
Sequence

1 - 

acuaccccagagaguuucaauc

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-509c-3p

Accession MIMAT0047326
Sequence

41 - 

uagaaaccucugagguggauu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).