Stem-loop sequence cpo-mir-509b

AccessionMI0038811 (change log)
DescriptionCavia porcellus miR-509b stem-loop
Stem-loop
   --       c  a  c          cua 
5'   uacuuca ag au ucgaucaugu   a
     ||||||| || || ||||||||||    
3'   augaagu uc ua agcuaguaua   a
   ag       a  c  -          aau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562939.1: 2748262-2748318 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-509b
cpo-mir-509aDS562939.1: 2739521-2739577 [+]
cpo-mir-509bDS562939.1: 2748262-2748318 [+]
cpo-mir-509cDS562939.1: 2752734-2752794 [+]
Database links

Mature sequence cpo-miR-509b-5p

Accession MIMAT0047323
Sequence

1 - 

uacuucacagaaucucgaucaug

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-509b-3p

Accession MIMAT0047324
Sequence

36 - 

ugaucgaauccuaugaaguaga

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).