Stem-loop sequence cpo-mir-507c

AccessionMI0038809 (change log)
DescriptionCavia porcellus miR-507c stem-loop
Stem-loop
   --       u          c  uguau 
5'   cacuuca ggagugccau ca     u
     ||||||| |||||||||| ||     a
3'   gugaagu cuucacggua gu     a
   gg       u          a  uugaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562939.1: 2771646-2771702 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-507c
cpo-mir-507aDS562939.1: 2762224-2762281 [+]
cpo-mir-507bDS562939.1: 2763265-2763322 [+]
cpo-mir-507cDS562939.1: 2771646-2771702 [+]
Database links

Mature sequence cpo-miR-507c-5p

Accession MIMAT0047319
Sequence

1 - 

cacuucauggagugccaucca

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-507c-3p

Accession MIMAT0047320
Sequence

37 - 

aauggcacuucuugaaguggg

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).