Stem-loop sequence cpo-mir-507b

AccessionMI0038808 (change log)
DescriptionCavia porcellus miR-507b stem-loop
Stem-loop
   --                 u   g  aaa 
5'   cacucaaaaaggugcca uca gu   u
     ||||||||||||||||| ||| ||    
3'   gugaguuuuuucacggu agu ua   u
   ac                 u   a  aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562939.1: 2763265-2763322 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-507b
cpo-mir-507aDS562939.1: 2762224-2762281 [+]
cpo-mir-507bDS562939.1: 2763265-2763322 [+]
cpo-mir-507cDS562939.1: 2771646-2771702 [+]
Database links

Mature sequence cpo-miR-507b-5p

Accession MIMAT0047317
Sequence

1 - 

cacucaaaaaggugccauuca

 - 21

Get sequence
Evidence not experimental

Mature sequence cpo-miR-507b-3p

Accession MIMAT0047318
Sequence

38 - 

auuggcacuuuuuugagugca

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).