Stem-loop sequence cpo-mir-507a

AccessionMI0038807 (change log)
DescriptionCavia porcellus miR-507a stem-loop
Stem-loop
   --          g      u   g  aaa 
5'   cacucaaaaa gugcca uca gu   u
     |||||||||| |||||| ||| ||    
3'   gugaguuuuu cacggu agu ua   u
   ac          a      c   a  aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562939.1: 2762224-2762281 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-507a
cpo-mir-509cDS562939.1: 2752734-2752794 [+]
cpo-mir-507aDS562939.1: 2762224-2762281 [+]
cpo-mir-507bDS562939.1: 2763265-2763322 [+]
cpo-mir-507cDS562939.1: 2771646-2771702 [+]
Database links

Mature sequence cpo-miR-507a-5p

Accession MIMAT0047315
Sequence

1 - 

cacucaaaaaggugccauuc

 - 20

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-507a-3p

Accession MIMAT0047316
Sequence

38 - 

acuggcacauuuuugagugca

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).