Stem-loop sequence cpo-mir-506

AccessionMI0038806 (change log)
DescriptionCavia porcellus miR-506 stem-loop
Stem-loop
   --    ug a       ca    a   au 
5'   uacu  g aaggugc  uuca uaa  u
     ||||  | |||||||  |||| |||   
3'   auga  c uuccgcg  aagu auu  a
   ag    gu c       ug    -   ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562939.1: 2699627-2699683 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-506
cpo-mir-506DS562939.1: 2699627-2699683 [+]
cpo-mir-12075DS562939.1: 2702877-2702952 [+]
Database links

Mature sequence cpo-miR-506-5p

Accession MIMAT0047313
Sequence

1 - 

uacuuggaaaggugccauuca

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-506-3p

Accession MIMAT0047314
Sequence

37 - 

aagugcgccuuccugaguaga

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).